Alt-R™ Cas9 Electroporation Enhancer from Integrated DNA Technologies

Product Specs
ItemAlt-R™ Cas9 Electroporation Enhancer
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Number1075915
ApplicationsGene Expression and Molecular Cloning
TypeEnhancer

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) Comprehensive identification of diverse ribosomal RNA modifications by targeted nanopore direct RNA sequencing and JACUSA2RNA BiologyDecember 31, 2023Isabel S. Naarmann-de Vries, Christiane Zorbas, Amina Lemsara, Michael Piechotta, Felix G. M. Ernst, Ludivine Wacheul, Denis L. J. Lafontaine, Christoph Dieterichconcentration 4 µM) in case of the point mutations. Cells were electroporated with an enhancer (IDT, #1075915, final concentration 4 µM) in a nucleofector device (Lonza, Nucleofector 2; programme D-032). Cells

(2) NINJ1 is activated by cell swelling to regulate plasma membrane permeabilization during regulated necrosisCell Death & DiseaseNovember 18, 2023Yves Dondelinger, Dario Priem, Jon Huyghe, Tom Delanghe, Peter Vandenabeele, Mathieu J. M. Bertrandfor 10 min. at room temperature. Next, Cas9-RNPs were mixed with 0.2 nmoles Electroporation enhancer (1075915, IDT) and incubated with 1.25 × 106 cells in a total volume of 100 μl Opti-MEM. Finally, cells were

(3) CFTR-rich ionocytes mediate chloride absorption across airway epitheliaJournal of Clinical InvestigationOctober 16, 2023Lei Lei, Soumba Traore, Guillermo S. Romano Ibarra, Philip H. Karp, Tayyab Rehman, David K. Meyerholz, Joseph Zabner, David A. Stoltz, Patrick L. Sinn, Michael J. Welsh, et al.Basic Nucleofector Kit for Primary Mammalian Epithelial Cells, Lonza), 1 × 106 cells, 1 μL Cas9 electrophoretic enhancer (IDT, 1075915), and 7.5 μL of each RNP used. The cell suspension was electroporated with Nucleofector 2b (Lonza, AAB-1001)

(4) An Aged/Autoimmune B-cell Program Defines the Early Transformation of Extranodal LymphomasCancer DiscoveryJanuary 9, 2023Leandro Venturutti, Martin A. Rivas, Benedikt W. Pelzer, Ruth Flümann, Julia Hansen, Ioannis Karagiannidis, Min Xia, Dylan R. McNally, Yusuke Isshiki, Andrew Lytle, et al.GCGGUACCAGAGCGGCAAGU-3’; Hs.Cas9.TBX21.1.AC “#2”: 5’-GAUUAAACUUGGACCACAAC −3’), electroporation enhancer (#1075915), and a tracrRNA-ATTO550 (#1075927; all from Integrated DNA Technologies; Coralville, IA, USA), following

(5) PP4 inhibition sensitizes ovarian cancer to NK cell-mediated cytotoxicity via STAT1 activation and inflammatory signalingJournal for ImmunoTherapy of CancerDecember 23, 2022Remya Raja, Christopher Wu, Esen Yonca Bassoy, Thomas E Rubino, Emma C Utagawa, Paul M Magtibay, Kristina A Butler, Marion Curtiselectroporated (BTX ECM 830, Harvard Apparatus) with ribonucleoprotein complex and electroporation enhancer (#1075915, IDT). The gene edits in single clones were verified by Sanger sequencing and p53 protein knockout was

(6) A disease-linked lncRNA mutation in RNase MRP inhibits ribosome synthesisNature CommunicationsDecember 1, 2022Nic Robertson, Vadim Shchepachev, David Wright, Tomasz W. Turowski, Christos Spanos, Aleksandra Helwak, Rose Zamoyska, David Tollerveyassembled with 5 µL of Cas9:gRNA mix (made above), 1 µL of 100 µM electroporation enhancer (IDT; cat.1075915), and 3 µL of 10 µM ssODN. Cells and transfection mix were combined and electroporated with a Lonza

(7) Glucocorticoids unmask silent non-coding genetic risk variants for common diseasesNucleic Acids ResearchNovember 11, 2022Thanh Thanh L Nguyen, Huanyao Gao, Duan Liu, Trudy Janice Philips, Zhenqing Ye, Jeong-Heon Lee, Geng-xian Shi, Kaleigh Copenhaver, Lingxin Zhang, Lixuan Wei, et al.the manufacturer's instruction in combination with the Alt-R® Cas9 Electroporation Enhancer (Cat#: 1075915, IDT). The result of CRISPR/Cas9 editing was evaluated with PCR and gel electrophoresis. Specifically,

(8) Sweet taste receptor agonists attenuate macrophage IL-1β expression and eosinophilic inflammation linked to autophagy deficiency in myeloid cellsClinical and translational medicineAugust 1, 2022Lee J, Kim SJ, Choi GE, Yi E, Park HJ, Choi WS, Jang YJ, Kim HS.100 μl) with a mixture of RNP including 500 pmoles of sgRNA, Cas9 (IDT, 1081061) and Enhancer (IDT, 1075915), and then transfected under program T‐20 Amaxa Nucleofector II system. Cells were then seeded, incubated

(9) Reduced Expression of TMEM16A Impairs Nitric Oxide-Dependent Cl− Transport in Retinal Amacrine CellsFrontiers in Cellular NeuroscienceJuly 27, 2022Tyler Christopher Rodriguez, Li Zhong, Hailey Simpson, Evanna Gleasonwere formed in the Cas9 dilution buffer. RNPs, electroporation enhancer (Integrated DNA Technologies, 1075915), and Nucleofector solution (Lonza, VPG-1002) were combined with 4–6 × 106 primary retinal neurons and

(10) FL118, acting as a 'molecular glue degrader', binds to dephosphorylates and degrades the oncoprotein DDX5 (p68) to control c-Myc, survivin and mutant Kras against colorectal and pancreatic cancer with high efficacyClinical and translational medicineMay 1, 2022Ling X, Wu W, Aljahdali IAM, Liao J, Santha S, Fountzilas C, Boland PM, Li F.1075932), IDTE pH 7.5 (1X TE solution; Cat# 11‐01‐02‐02) and Alt‐R Cas9 Electroporation Enhancer (Cat# 1075915) from Integrated DNA Technologies; we also made orders of QuickExtract DNA extract solution (Cat# QE0905T)

(11) A novel CD4 knockout mouse strain with a spontaneous frameshift mutation in the CD4 locusPLOS ONEApril 6, 2022Mathangi Janakiraman, Shin-Young Na, Gurumoorthy Krishnamoorthybuffer R (Thermo Fisher Scientific). 1.5 μl crRNA–tracrRNA duplex, 0.5 μl electroporation enhancer (1075915; IDT technologies) and 0.5 μl of 100 μM HDR template was added to the cells and gently mixed. The mixture

(12) Genome-wide identification of the genetic basis of amyotrophic lateral sclerosisNeuronMarch 16, 2022Zhang S, Cooper-Knock J, Weimer AK, Shi M, Moll T, Marshall JNG, Harvey C, Nezhad HG, Franklin J, Souza CDS, et al.Alt-R S.p. Cas9 Nuclease V3,Integrated DNA technologies,#1081059 Alt-R Cas9 Electroporation Enhancer,Integrated DNA technologies,#1075915 Dulbecco’s Modified Eagle medium,Lonza,#12-604F KnockOut DMEM/F-12,ThermoFisher Scientific,#12660012 Neurobasal medium

(13) Nuclear export restricts Gdown1 to a mitotic functionNucleic Acids ResearchFebruary 28, 2022Christopher B Ball, Mrutyunjaya Parida, Juan F Santana, Benjamin M Spector, Gustavo A Suarez, David H PricetracrRNA duplex into HeLa or HAP1 cells. In general, for knockouts, 100 pmol of a carrier DNA (IDT 1075915) was included to enhance electroporation. For knock-ins, an ssDNA donor template was included that also

(14) HOTTIP-dependent R-loop formation regulates CTCF boundary activity and TAD integrity in leukemiaMolecular cellFebruary 17, 2022Luo H, Zhu G, Eshelman MA, Fung TK, Lai Q, Wang F, Zeisig BB, Lesperance J, Ma X, Chen S, et al.,Integrated DNA Technologies,Cat#1072532 Alt-R® Cas9 Electroporation Enhancer,Integrated DNA Technologies,Cat#1075915 Protease inhibitor Cocktail,Abcam,Cat#ab65621 Dynabeads™ Protein G,Thermo Fisher Scientific,Cat#10003D Dynabeads™

(15) Interrogation of the dynamic properties of higher-order heterochromatin using CRISPR-dCas9Molecular CellOctober 21, 2021Yuchen Gao, Mengting Han, Stephen Shang, Haifeng Wang, Lei S. Qimolar ratio. 10 pmol of the mixed gRNAs together with 0.25 μL electroporation enhancer (IDT, 100uM, Cat#1075915) were transfected into 4×105 suspended U2OS pSLQ4356 L-A5 pSLQ6901 cells using the standard protocol

(16) Functional correction of CFTR mutations in human airway epithelial cells using adenine base editorsNucleic Acids ResearchOctober 11, 2021Sateesh Krishnamurthy, Soumba Traore, Ashley L Cooney, Christian M Brommel, Katarina Kulhankova, Patrick L Sinn, Gregory A Newby, David R Liu, Paul B McCraymixed with 10 μl of RNP and 1 μl of 100 μM electrophoretic enhancer (IDT, Coralville, IA, catalog #1075915). The cell suspension was electroporated using the Lonza Nucleofector 2b device (catalog #AAB-1001)

(17) A functional assay for serum detection of antibodies against SARS-CoV-2 nucleoproteinThe EMBO journalSeptember 1, 2021Albecka A, Clift D, Vaysburd M, Rhinesmith T, Caddy SL, Favara DM, Baxendale HE, James LC.chambered coverslips,Ibidi,41122111 Cas9 protein,IDT,#1081060 Alt‐R Cas9 Electroporation Enhancer,IDT,#1075915 Software,Software,Software Compass,Bio‐Techne,https://www.proteinsimple.com/compass/downloads/ Eclipse

(18) Rapid interrogation of cancer cell of origin through CRISPR editingProceedings of the National Academy of SciencesAugust 10, 2021Weiran Feng et al.cells were resuspended with nucleofection buffer, cRNP complexes, and electroporation enhancer (IDT 1075915, 1:1 molar ratio to cRNP) in a total volume of 100 µL. The cell suspension was transferred to a nucleofection

(19) CRISPR/Cas9 ribonucleoprotein-mediated knockin generation in hTERT-RPE1 cellsSTAR ProtocolsJune 18, 2021Sabrina Ghetti, Matteo Burigotto, Alessia Mattivi, Giovanni Magnani, Antonio Casini, Andrea Bianchi, Anna Cereseto, Luca L. FavaAlt-R® CRISPR-Cas9 crRNA,IDT™,N/A Alt-R® CRISPR-Cas9 tracrRNA,IDT™,Cat# 1072532 Alt-R® Cas9 Electroporation Enhancer,IDT™,Cat# 1075915 Ultramer® DNA Oligonucleotides,IDT™,N/A HPRT1 crRNA: 5′ GCATTTCTCAGTCCTAAACA 3′,"(Yu et al., 2016)",N/A HPRT1

(20) CRISPR-edited megakaryocytes for rapid screening of platelet gene functionsBlood advancesMay 11, 2021Montenont E, Bhatlekar S, Jacob S, Kosaka Y, Manne BK, Lee O, Parra-Izquierdo I, Tugolukova E, Tolley ND, Rondina MT, et al.throughout. crRNA, trans-activating CRISPR RNA (tracrRNA) (IDT #1072532), and electroporation enhancer (IDT #1075915) were resuspended to 100 mM in 10 mM tris(hydroxymethyl)aminomethane (Tris; pH 7.5), and stored at 220°C

Be the First to Write a Review!

Alt-R™ Cas9 Electroporation Enhancer from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (28)

Reviews

Alt-R™ Cas9 Electroporation Enhancer from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map